天美传媒

天美传媒 Sequencing Facility

Preparing samples for Illumina sequencing

Normalise the concentrations of your samples

Samples submitted  should be normalised to a specific concentration and  volume depending on the method selected. Sample requirements, minimum concentrations and volumes are given for each library preparation option listed below. 

If 16 samples or fewer are submitted to the sequencing facility, the samples should be submitted in strip tubes or Eppendorf 1.5 ml Low DNA bind tubes (#0030108051). If more than 16 samples are submitted per project, samples should  be provided in an Eppendorf twin.tec® PCR plate 96 LoBind, skirted  (# 0030129512 with Eppendorf cap strips ( # 0030124839) to seal the plate. Samples should be ordered by column (vertically, eg. for 24 samples, fill the plate from A1 to H3).

All plates and tubes must be labelled with the project ID; tubes should also be labelled with the sample ID using permanent marker or freezer labels.

Genomic sample requirements

Fragment libraries are prepared with inserts of 200-500 bp unless otherwise specified.

  • DNA should be dissolved in low TE buffer (10mM TRIS and 0.1mM EDTA, pH8) or Elution Buffer (10mM TRIS, pH8) and sent either on dry ice or packaged with ice or cool blocks.
  • Please do not send the sample lyophilised.
  • DNA samples should be free of RNA so an RNase treatment is highly recommended (treat the samples with RNAse A at the beginning of your preparation; 20 µl of a 20 mg ml-1 solution can be added during the cell pellet resuspension.
  • The amount of DNA submitted depends on the application:
    • Fragment library preparations 0.5-2.0 μg of gDNA (ideally 20 ng μl-1 in 55 μl)
    • PCR-free library preparations 2-5 μg of gDNA (min 40 ng μl-1 in 50 μl)

Tagmentation-based library preparation is not advised where genomes have extreme GC bias.

  • Use a lysozyme, or another gentle means of disrupting the cells prior to DNA isolation rather than using a bead based fragmentation process.
  • Use a column based clean-up such as QIAgen MiniElute/QIAquick, Zymo or Sigma Bacterial Genomic DNA extraction columns.
  • DNA should be dissolved in water or EB and not in TE buffer
  • The amount of DNA submitted depends on the application:
    • Illumina PCR-free 100-2000 ng of gDNA (min 4 ng μl-1 in 55 μl for small genomes (bacteria) or 20ng μl-1 in 55 μl for large genomes (human) 

Damaged DNA, or samples where single-stranded DNA viruses are expected, can be sequenced using xGEN ssDNA & low input DNA which sequences both single-stranded as well as double stranded DNA in a single preparation. It is advantageous for metagenomics, oncology/liquid biopsy, ChhIPseq, FFPE extracted DNA and ancient DNA. 

DNA fragments from 40 nucleotides can be represented in the libraries, normally fragments of 200 or 500 nucloetides are prepared unless specified.

DNA should be dissolved in low-EDTA TE (10mM Tris pH8.0, 0.1 mM EDTA)

DNA samples should be normalised to 16 ng μl-1 in a volume of 17 μl. If samples are more dilute, the lowest DNA requirement is 0.7 pg μl-1 in 17 μl.   

For low quality DNA samples, we recommend quanification by qPCR using the Alu primer pairs  (see to accurately assess the usable amount of DNA in the samples and their integrity.

 

NB The xGEN ssDNA & low input DNA library preparation method adds a low complexity polynucleotide tail with an average length of 8 bases to the 3’ end of each fragment during the addition of the first NGS adapter molecule. If these tails are not trimmed bioinformatically from the sequencing data, it is normal and expected to observe them at the beginning of Read 2 (R2). When read length is close to fragment size, the tail may also be observed toward the end of Read 1 (R1) data. For specific tail trimming recommendations, please consult our

Please supply the following with your samples:

  • DNA should be run on a 0.8-1% agarose gel to assess quality. DNA should be high molecular weight and not degraded.
  • DNA should be quantified by fluorimetry using either a Qubit fluorimeter (Life Technologies) with QUANT-iT dsDNA assay (Broad Range or High Sensitivity) or the Pico Green assay (Life Technologies).
  • Spectrophotometry methods may provide additional information but are generally inaccurate for quantitation due to the presence of small nucleic acids and contaminating chemicals.

N.B. If you are preparing your own libraries, we will rely on your quantification for sequencing. Please ensure these are accurate. Do not assume that size selection steps are sufficient to remove adaptor dimers. These small fragments will migrate with larger material and can bleed through size selection. It is imperative that qPCR and Bioanalyser/Tapestation smear analyses are undertaken after library construction.

Pre-made libraries, 25 μl minimum at 10 nM

Transcriptomic sample requirements

  • RNA should be prepared, or at the least final preparations cleaned up, using a commercial kit such as Qiagen RNAeasy, with on-column DNase digest.
  • RNA should be supplied pure dissolved in nuclease-free water.
  • RNA should be DNAse-treated and free from chemical contaminants, especially organic solvents.
  • RNA should be sent on dry ice, ensuring there is enough dry ice to keep the samples frozen until delivery. Alternatively, when a vacuum concentrator is available RNA samples can be sent in RNAstable tubes (Biomātrica #93221-001) in moisture barrier bags with desiccants (see the  or  websites).

The amount of RNA submitted depends on the application:

  • Illumina stranded mRNA libraray preparation 50ng –2 μg of total RNA (min 1 ng μl-1 in 50 μl), ideally 20ng/ul in 55 ul
  • Illumina total RNA for rRNA depletion from eukaryotic or bacterial samples  1 ng –1 μg of total RNA (min 25 ul at 0.1ng/ul to 100 ng/ul), ideally 50ng/ul in 25ul
  • NEBNext UltraII directional RNA libraries using polyA-isolation: 20 ng to 2ug RNA, ideally 10ng/ul in 105ul
  • Small RNAs 1-2 μg total RNA or small RNAs extracted from 1-2 μg RNA
  • Pre-made libraries; 25 μl minimum at 10 nM
  • RNA quality should be checked on a fragment analyser to assess the RNA fragment sizes and provide a RNA Integrity Number (RIN), RNA Integrity Score (RIS), RNA Quality Score (RQS) or RNA Quality Number (RQN); numbers which should be > 8 for vertebrate RNA (shown on the Bioanalyser result page). If a fragment analyser is not available then the RNA may be a run on a denaturing 0.8-1% agarose gel.
  • RIN numbers (or equivalents) may not be appropriate for species where the RNA fragments into nonstandard sizes, such as insects, nevertheless fragment profile can still be very informative, however, the fragment analyser does not always provide accurate concentrations.
  • RNA quantity should be calculated using fluorometry, preferably using Qubit fluorometer with QUANT-iT RNA assay (Life Technology).
  • Spectrophotometry methods can provide additional information about the purity of the RNA: pure RNA should yield A260/A280 ratio of 2.0-2.2, however there is little consensus regarding the lower limit of this ratio. Chaotropic salts, carbohydrates, peptides and phenol can contribute to increased absorbance at 230 nm, but by far the most common contaminant is guanidine thiocyanate present at high concentration in extraction reagents in many RNA purification methods. A A260/A280 ratio between 2.0-2.1 indicates RNA without protein contamination.

ChIP-Seq sample requirements

Minimum 10 ng of ChIP DNA fragmented to 400-600 bp (min 0.2 ng μl-1 in 50 μl)

Amplicon sample requirements

Amplicon libraries can be prepared by ligation of adapters to gel purified amplicons or by generating the entire library using primers that contain additional 5’ sequence during PCR amplifications. PCR products should be gel purified after multiple PCR reactions (typically 4-6 reactions) and pooled for each sample. Do not assume that size selection steps are sufficient to remove adaptor dimers. These small fragments will migrate with larger material and can bleed through size selection. 

  • 1-2 μg gel-purified PCR product dissolved in 10 mM TrisHCl (pH7.5) or EB required for ligation based libraries
  • 10-100ng DNA for PCR amplified libraries

Please supply the following with your samples:

  • Check the DNA on a fragment analyser to determine the spread of the peak or region and ensure that all primers have been removed.. If a fragment analyser is not available then the DNA may be a run on a 0.8-1% agarose gel.
  • DNA should be quantified by fluorometry using either a Qubit fluorometer (Life Technologies) with QUANT-iT dsDNA assay (Broad Range or High Sensitivity) or the Pico Green assay (Life Technologies).
  • Spectrophotometry methods may provide additional information but are generally inaccurate for quantitation due to the presence of small nucleic acids and contaminating chemicals.

N.B. If you are preparing your own libraries, we will rely on your quantification for sequencing. Please ensure these are accurate.

Illumina amplicon library preparation by PCR

Amplicon sequencing requires at least 20ul of 10ng/ul extracted gDNA for each sample.? Our standard method uses a two-step PCR process togenerate the library based on the Illumina amplicon protocol. Experimental design for microbiome research is important and some suggestions can be found at Considerations for microbiome sequencing?

.

We provide primers for the most common loci for?amplicon?library preparation described in the table below,however, with some additional planning and optimization included, we can theoretically amplify and sequence any locus of interest for your project.?You will need to supply the primers (NGS quality) and pay for the optimisation; these projects may take a little longer.Standard projects will be sequenced on the MiSeq giving 250 or 300 PE reads with a maximum of 190 samples per run. The MiSeq v3 600 offers a maximum yield of approximately 15 Gb under ideal conditions, given the lower complexity of amplicons, it is often necessary to load at a lower density and so for amplicon sequencing you would expect more like 7Gb of data from this particular flowcell. MiSeq v2 500 would be expected to provide half the data of the Miseq v3 600. 

Primers foamplicon sequencing

Gene Region Primer Sequence
Prokaryote 16S V1-V3 16S_3-27F  AGAGTTTGATCCTGGCTCAG
    16S_518-536R GTATTACCGCGGCTGCTGG
  V3-V4 16S_341F CCTACGGGNGGCWGCAG 
    16S_785R  GGACTACHVGGGTATCTAATCC?
  V4 16S_515F GTGYCAGCMGCCGCGGTAA 
    16S_806rB  GGACTACNVGGGTWTCTAAT 
Archaea V1-V2 SSU1ArF  TCCGGTTGATCCYGCBRG
    SSU280ArR  TCAGWNYCCNWCTCSRGG 
Eukaryotic 18S  V9 18S_Euk_1391f  GTACACACCGCCCGTC 
    18S_EukBr  TGATCCTTCTGCAGGTTCACCTAC
  V9 18S_V9_1389F TTGTACACACCGCCC
    18S_V9_1510R  CCTTCYGCAGGTTCACCTAC 
Fungi ITS1 ITS1f (forward) CTTGGTCATTTAGAGGAAGTAA
    ITS2 (reverse) GCTGCGTTCTTCATCGATGC
  ITS2 ITS3 (forward) GCATCGATGAAGAACGCAGC
    ITS4 (reverse) TCCTCCGCTTATTGATATGC
    ITS_LR3  CCGTGTTTCAAGACGGG
    ITS_LR22R TAGCGMACAAGTASMGTG
Plant ITS ITS_PlantF TGTGAATTGCARRATYCMG
    ITS_PlantR CCCGHYTGAYYTGRGGTCDC
Eukaryotic species CO1 Sauron-S878 GGDRCWGGWTGAACWGTWTAYCCNCC
    jgHCO2198 TAIACYTCIGGRTGICCRAARAAYCA 

 

Illumina Amplicon library preparation: 

PCR1 amplifies your locus/loci of choice and adds pad sequences to either end of your amplicons, which will serve as priming sites for the second PCR reaction.? Every project is customizable but typically this reaction gets 12-20 amplification cycles.? Most users want a single PCR reaction* to represent each sample, we can run duplicate or triplicate PCRs for each sample upon request which will incur additional charges.? After product purification PCR2 primes off the pad and adds unique dual indexes (UDIs) to either side of your molecule.? It is typically 4-12 cycles. UDIs reduce the occurrence of barcode switching which results in data bleed within samples. Positive amplification for PCR2 is checked by size and concentration. Samples are pooled equimolar unless uneven pooling is requested.? Final pool(s) are quantified by qPCR before running on the sequencer. 

Amplicon Sample Submission

We request at least 20ul of 10ng/ul extracted gDNA for each sample.? We can work with less, but low concentrated samples decrease your chances of the PCR working the first time, and all additional time/effort spent on getting your samples to amplify can incur additional costs.?The size of the DNA input is also important because environmental DNA extracted from soil or faeces may have low molecular weight impacting amplification.We require that samples be quantified with a Qubit or Picogreen assay prior to submission and a gel image with appropriate marker.? We strongly encourage you to normalize your DNA prior to submission, though it is not required.??Submissions in tubes and without concentration information will incur additional charges. PCR fees will also be charged for any samples that repeatedly fail amplification. 

*The benefits of PCR replication is a longstanding and contested debate.? It can matter more or less for certain applications, but for a useful analysis is provided in :? 

 

RAD-seq

Please contact us for more information. Typically the first attempt at a project will require more material to select suitable restriction enzymes.